There's no point in having a loop if you were just going to have it run once. Note that this loop runs three times, to print the three different frames. The addition of 79.0 gm/mole to the oligonucleotide molecular weight takes into account the 5 monophosphate left by most restriction enzymes. # translate the base sequence to amino acids and print it If you would like an accurate MW for restriction enzyme cut DNA, please use: Molecular Weight (A n x 313.21) + (T n x 304.2) + (C n x 289.18) + (G n x 329.21) + 79.0. the three frames, you would use something akin to the final loop in joaquin's answer, rseq = reverse_complement(seq) The OligoAnalyzer Tool accommodates DNA, RNA, mixed bases, and a variety of. Enter your sequence into the Sequence box in the 5’ to 3’ orientation (Figure 2, arrow A). The OligoAnalyzer Tool link is found under the Oligo Design & Handling section. split('|') unless your amino_acids dictionary contains multiple representations separated by |.įinally, to do this for the three different possible ways of converting the bases to amino acids, i.e. Select the OligoAnalyzer Tool from the TOOLS menu on any IDT webpage. Return ''.join(amino_acids for a in zip(*(*3))) So you could define a method like this: def to_amino_acids(seq): The mass will be updated once the formula changes to calculate a formula in a cell, just type something like this MW ('CaCO3'). Then you look up the string in the amino acid table, which is done by amino_acids.įinally you need to join all the resulting amino acid codes together, which can be done by an outer ''.join(.). Download and open Excel file and edit it as needed. for 'TATATA' you'd get ('T', 'A', 'T'), ('A', 'T', 'A'), so you need to join each tuple to make a string. But it does so as tuples, not strings, e.g. seq = "CCGGAAGAGCTTACTTAG"īasecomplement = Īnd you can then use this to convert any sequence of bases, amino_acids for a in zip(*(*3))īy way of explanation, zip(*(*3)) groups the characters three at a time. I have tried the next code to get my results, but so i get just a complementair seq. The one with +3 is the amino acid sequence corresponding to my complementary sequence beginning with the third base.The one with +2 is the amino acid sequence corresponding to my complementary sequence starting at the second base.The one with +1 is the amino acid sequence corresponding to my complementary sequence.If SeqNT contains ambiguous N characters, GC is the. Ambiguous N characters in SeqNT are considered to potentially be any nucleotide. Percent GC content for the DNA oligonucleotide. The second one is the complementary sequence, SeqProperties oligoprop (SeqNT) returns the sequence properties for a DNA oligonucleotide as a structure with the following fields: Field.The fist sequence is the normal sequence,.+3 TyrIleTyrIleTrpValMetLeuArgLysGlyValProThrLeuValMetLeuValLeuLys +2 IleTyrIleTyrMetGlyHisAlaThrOc*GlyGlySerHisPheGlyHisAlaSerIleglu +1 TyrIleTyrIleTyrGlySerCysTyrValArgGlyPheProLeuTrpSerCysStpTyrStp TATATATATATATATGGGTCATGCTACGTAAGGGGGTTCCCACTTTGGTCATGCTAGTATTGAAA I have to translate the complement of a DNA sequence into amino acids TTTCAATACTAGCATGACCAAAGTGGGAACCCCCTTACGTAGCATGACCCATATATATATATATA
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |